Monday, September 30, 2019
Immune system
Chapter 1: IntroductionTypically, the immune system can spot between ââ¬Å"selfâ⬠and ââ¬Å"not selfâ⬠and onslaughts merely those tissues that it recognizes as ââ¬Å"not selfâ⬠. This is often the preferable reaction, but non ever. Autoimmune upsets are diseases produced by the organic structure doing an inappropriate immune reaction hostile to its ain tissues ( American Association for Clinical Chemistry 2009 ) . The immune system will halt placing one or more of the organic structure ââ¬Ës normal parts as ââ¬Å"selfâ⬠and will make ââ¬Ëautoantibodies ââ¬Ë , which attack its ain cells and systems. Systematic Lupus Erythematosus is an inflammatory autoimmune disease of unspecified etiology, and is characterized by a wide assortment of symptoms ( Herrmann, Voll & A ; Kalden 2000, Rudich & A ; Zerman et.al. 2008, Olowu 2007, Hansen, Heipe, & A ; Dorner 2007 ) . Lupus can be triggered by legion agencies and can show itself in a bewildering figure of way s, even to the extent of miming other diseases such as arthritic arthritis or multiple induration. Although Lupus affects many variety meats some of the more common symptoms are utmost weariness, joint hurting, the devastation of critical variety meats, every bit good as musculus achings ( The Lupus Site 2009 ) . Symptoms of Lupus can look and decline with clip, and they vary from individual to individual ; symptoms of Lupus can escalate with flare-ups, but these can besides unclutter up. Outbursts may be triggered by alterations in the patient ââ¬Ës wellness position, such as physical or emotional stressors and/or by outside stimulations. Lupus is non a normally discussed disease, although it has been said that it is more common than leukaemia, muscular dystrophy, and multiple induration. It is estimated that 30,000-50,000 people in the United Kingdom have Lupus, of which 90 % of its sick persons are female ( Lupus UK 2005 ) . Based on fieldwork, Internet posters, and published documents on unsure diseases, this paper examines ways in which sick persons attempt to derive diagnosings. I turn to the corporate online action, where users grapple with the systemic nature of wellness attention denial ; they discuss wellness attention, and utilize these treatments to make tactics that the weak can utilize in response to the domination of the medical system. However, because of the pervasiveness and uncertainness of the unwellness, the biomedical facts are susceptible to being framed and reframed by participants in these treatments. Lupus characterized by great uncertainness sing etiology, diagnosing and intervention ; it is an emergent disease, in that it is researched in the medical community, discussed and reported on on occasion, nevertheless it is non settled upon in respects to diagnosis. There are many structural features of Lupus, and these should be taken into history, as they play major functions in on-line treatments and methods of get bying with the disease. First, Systemic Lupus Erythmatosus is a chronic status, and portions with other chronic conditions, the inability of suiting into acute disease theoretical accounts of intervention, the ill function, and wellness attention. Second, Lupus is a biological status that is fraught with mental features ; and due to this it is frequently misdiagnosed as a mental status. This is added onto the fact that the oncoming of lupus is contested as to societal, familial, or toxic finding ; precisely what causes the oncoming of the disease is unknown. Lupus is therapeutically diverse, how people treat their status and what therapies that are used are varied. There are common drugs that are prescribed one time diagnosed, including a batch of steroids, nevertheless alternate medicine is broad unfastened. Lupus is a disease that is characterized by fuzzed boundaries and is cross-linked to other unwellnesss and complaints as misguided diagnosing. And eventually Lupus can be lawfully volatile ; conditions can be caught up in legal conflicts and extended administrative cataloging. When seeking disablement position, it can be applied at a caprice ; it is a extremely contested position, as the disease is an ââ¬Ëinvisible disease ââ¬Ë . A late diagnosed patient best summarizes the structural conditions listed above: ââ¬Å" I was late diagnosed with lupus, I sometimes wonder why the physicians could n't hold found it earlier now. It has been 3 old ages since my first symptoms. I knew that something was non right. I was misdiagnosed with several complaints and was get downing to believe it was all in my caput or that I was doing it up. It ââ¬Ës amusing how you even get down to doubt yourself. But something told me to maintain delving maintain take a firm standing that something has to be incorrect. I feel so much better now that I know what it is I am confronting. It is the unknown that is scary.â⬠Many lupus patients frequently say they feel like hypochondriacs when sing their physician because of all the minor symptoms that they want to describe. It can be a long, difficult route to acquire a diagnosing and it ââ¬Ës easy to desire to give up. Sometimes, even their households begin to oppugn whether there is anything truly incorrect. Diagnosis is one of the few ways that sick persons feel that they can derive legitimacy in the eyes of society, a manner in which they can accommodate the ill function with a solid backup to it. Suiting into society and the topographic point that Lupus sick persons have within society frequently leads to a automatic theorizing about society, which will be touched on later in the paper. As with many emergent, contested unwellnesss, the societal job is the seemingly intractable uncertainness at each bend. There are ever excessively many facts, excessively many symptoms to name, and non plenty research done. The battle to acquire diagnosed therefo re depends disproportionately on the little sum of research and promotion of the disease ; and many sick persons feel that they are consistently excluded from the medical system. Beck has shown how life in modern society necessitates the demand to hold a ââ¬Ëdo it yourself ââ¬Ë attitude. The corporate histories of experiences with physicians online let for a creative activity of a tool-kit to conflict against the changeless denial of the sick-role. In the balance of this paper, I will utilize the online forums among sick persons to analyze what they have learned in order to populate and speak strategically in the medical system, in society, and in the household puting that invariably denies them their unwellness, and the tactics that are used.Chapter 2: MethodsThis chapter is dedicated to discoursing the methods used to make the transcripts that shaped the foundation for the analysis of lupus sick persons ââ¬Ë battle for acknowledgment and methods of covering with the denia l of the ill function. In peculiar, this chapter will turn to the lineation for the readying of the interviews, how the marks were reached, and the ethical issues that were met. I will besides explicate the procedural grounds behind utilizing the online forums and questionnaires as the underpinning of the survey, every bit good as the restrictions that these beginnings provided. The usage of critical descriptive anthropology for this undertaking was cardinal in constructing a better apprehension of unwellness as a societal and biological fact. Systematic Lupus Erythematosus is an unwellness that is beset with medical and societal stigma, an unwellness that is surrounded by uncertainness, and is frequently referred to as an ââ¬Ëinvisible disease ââ¬Ë ; which is discussed in the undermentioned chapters. The chief purpose of research was to look at how sick persons were talking about their experiences with Systematic Lupus Erythematosus and how they were discoursing their jobs and tactics together in a public forum. In order to turn to this, the primary informations used are in-depth interviews conducted with Lupus sick persons, their household members, and assorted usage of on-line treatment groups. I turned to online action in order to follow how the highly systemic character of medical denial can be archived, argued and used to make tactics against thi s really denial. The posters in the forums are public commentary with no entree limitations and are frequently personal narratives about fighting with acquiring diagnosed. The majority of the information for this undertaking came from posters such as this, and was spread between three chief yarn subjects ââ¬ËLiving with Lupus ââ¬Ë , ââ¬ËNot Diagnosed Yet? ââ¬Ë and ââ¬ËSymptoms ââ¬Ë , as there are over 53,000 positions and 9000 posters. Use of these on-line beginnings opened up the sum of people I could make in respects to my research. Data for this undertaking was collected between the months of April 2009 and August 2009, from life history interviews, online questionnaires, on-line treatment groups, every bit good as participant observation from support group meetings. There was no effort at reaching people separately in order to take part in these surveies, nevertheless the online community was given the chance to reach me if they wished to take part in the survey. Preparation for the interviews was undertaken through shoping the online forums and analysing which subjects were looking the most in posters. From the subjects that appeared the most through out the togss I created a synonym finder of common footings, this synonym finder was used to code the conversations that were held on the togss. Equally good as analyzing through the togss I undertook big readings of scientific diaries on the topic of Lupus. This was done in order to derive background cognition on the topic, to derive utile ushers prior to furthe r research, and to entree informations that already exists from past research on Lupus. Attention was paid to the quality and cogency of beginning stuffs by utilizing assorted paperss published by different bureaus. Internet informations such as Google Scholar, JSTOR, PubMed, and Academic Search Complete provided me with a wide hunt country to acquire a assortment of Lupus paperss published. Particular attention was besides taken into looking at the research that sick persons were posting on the Lupus web site, of which there were merely 72 stations available on the UK Lupus web site. Reading these paperss, analysing the on-line posters, and taking attention to observe what the responses were to these on-line stations formatted the footing for all interview inquiries. Fieldwork was cultivated through contact with the decision maker of a UK based Lupus support web site. It was through this medium that I garnered permission to post a description of my research ; which allowed me to reply inquiries environing the usage of my research, and on the content of my research. The bulk of my sources were Lupus sick persons, although a few participants were the household members of those diagnosed with Lupus. Those that were included in the response had all been diagnosed with Lupus, although there was a big community of online users that were in contact that had symptoms of the disease, but yet were non diagnosed. Peoples that were included in the undertaking were all 1s that had been officially diagnosed with Lupus or their household members, this was non a de-legitimization of those who were non officially diagnosed, but those that volunteered their life histories and replies were those that had been officially diagnosed. The interviews were set up after r eaching a big database of lupus sick persons, which were followed up with posters on the online forum. Interviews ranged from one to three hours long, which were followed up upon with the persons at subsequently day of the months. Following the interviews with Lupus sick persons, I formulated an online questionnaire that people could make full out anonymously, this method allowed me to include those that did n't desire to take part in interviews, but still wished to show their positions on the research subject. Questions that were posted online were wide open-ended inquiries, which were used with the purposes of acquiring respondents to give a greater history of their experiences and jobs. This on-line questionnaire was posted by my research proposal, on the online forum, every bit good as circulated via electronic mail to assorted Lupus sick persons. Regular users and intermediate users of the site all had entree to my research proposal, which got over 600 reads after posting. By posting up my research proposal I allowed for the participants of the survey to cognize precisely what I was research, and how I wanted to accomplish these ends. It besides allowed them to subject inquiries and general enquiries, this feedback that I received from sources have been fed back into my research and developed the findings presented here. Having already touched really briefly the ethical concerns earlier, it would look practical to turn to them at this point. Covering with informations that concerns persons ââ¬Ë lives means that allowing namelessness to the individuality of the person and anyone else they may advert is a main concern. Permission for my research was given by the UK Lupus website decision maker, and although this permission was given officially I besides the purposes and aims of my research accessible and clear by posting my proposal for sing anterior to engagement in the research undertaking. Persons besides gave their countenance prior to questioning and were made aware of the right to retreat their part at any phase. Transcripts of the interviews have been made for my ain usage but to protect the individuality of the participants the anonym they used online were kept. Anything that the participants wanted to retreat in hindsight was besides taken into history. For the posters in the three above-na med togss no consent was taken, as all subscribers use anonym. The usage of anonym at times can be a drawback in the research, as these give no indicant of their societal position, their sex, or their age.Chapter 3: Literature Reappraisal:ââ¬Å"Truth is to be understood as a system of ordered processs for the production, ordinance, distribution, circulation, and operation of statements.â⬠Michael Foucault The foundations of medical anthropology are legion, but some of the most influential beginnings are the physical anthropologist ââ¬Ës research in development, version and other domains, the ethnographic wonder in witchery and thaumaturgy, the partnership of anthropologists and psychologists during the wartime period, and eventually the international public wellness motion that occurred after World War II ( Foster & A ; Anderson 1978 ) . Following from World War II, the survey of ââ¬Ëpopular and modern medical specialty ââ¬Ë became an of import country of research, with comparings between modern biomedicine used in the western universe and the ethno-medicine beginning to rule the medical anthropology sphere ( Bendix 1967, Foster & A ; Anderson 1978, Press 1978, & A ; Simmons 1955 ) . History, clip, and procedures within societies have frequently been combined into one overarching class ; nevertheless Hagiographas from Evans-Pritchard have drawn attending to the integrity of a nthropology and history when discoursing societal orders, and these societal orders can non be analyzed without cognition refering its ââ¬Ëinternal kineticss ââ¬Ë ( Comaroff & A ; Comaroff 1992 ) . Put merely all societies are involved in procedures with multiple constituents, elements which create a societal environment, and these constituents engage human histrions and different bureaus in a dialectical relationship ( Comaroff & A ; Comaroff 1992 ) . Ethno-medicine and disease etiologies acknowledge and incorporate input from assorted beginnings, including ââ¬Å"economic, familial, ritual, moral and other institutional sectorsâ⬠( Press 1978:71 ) , whereas the modern ( biomedicine ) can be seen as a ââ¬Å"closed system, ââ¬Ëbased on exactly defined cognition, technique and processs, all of which are discontinuous from ordinary societal process'â⬠( Press 1978:71 ) . ââ¬Å"Human life can non be studied without taking into history both how persons are situated within and constrained by societal constructions and how those persons construct an apprehension of and enforce intending on the universe around themâ⬠( Dressler 2001:455 ) . Explanatory theoretical accounts of unwellness ( EM ) are a set of beliefs which provide people with ways of believing about manners of and theoretical accounts for world, they create order and significance ; this set of beliefs is constructed non by a civilization, but by persons ( Young 1982 ) . Illness can be seen as a procedure through which disease is given socially identifiable significances ( Crandon 1983, Young 1982, Foulks 1978 ) . The manner in which people describe their societal universe through medical specialty is a contemplation of political and economic worlds of the clip ; it shows the significance of cultural dealingss ( Crandon 1986 ) . Cultural individuality can impact straight the type of unwellness believed to hold ( Crandon 1983 [ B ] , Last 1990, Press 1978, Simmons 1955 and others ) , and therefore affects the type of intervention that people are seeking. The medicative system utilised can go a cultural sphere from which people negotiate their individuality, ââ¬Å"medical political orientation is a peculiarly powerful instrument through which certain sorts of dialogue take topographic point ; specifically those refering to cultural individuality, how people define themselves and others and their ain relationships to othersâ⬠( Crandon 1983 [ A ] :79 ) . There are three chief ways that person seeks intervention: ââ¬Å"self-treatment, intervention by a curer, or intervention by medical doctorsâ⬠( Reeve 2000:102 ) , and these picks are made based upon the gravitation of the unwellness every bit good as the type of intervention that is required ( for either societal grounds, or the cause of the unwellness ) . Within these methods of intervention, there are countries of convergence and intermingling. Medical systems, while of import indexs of political and economic state of affairss, and a duologue of cultural dealingss, should be grappled with non merely as systems of idea, but as thought-in-use ( Worsley 1982 ) . In short, medical beliefs play an of import function in the daily lives ; they have historical significance, influence behavior, form cultural individuality, and represent a dialectical relationship with a huge scope of agents. The hurting that is experienced by persons is influenced to a great extent by their personality, societal and cultural background, every bit good as the doctor-patient interaction ( Rudich et. al 2008 ) . The manner in which the organic structure, unwellness, and hurting are understood is under direct influence of emotions, which is shown in images of the operation organic structure politic and societal organic structure ( Lock 1993, Scheper-Hughes & A ; Lock 1987 ) . It has been argued that it is virtually ââ¬Å"impossible to free powerful human experiences of metaphor, of cultural representation ( although it is, of class, both possible and in many instances necessary to alter the images and significances of illness, hurting, and enduring ) â⬠¦that the hypostatization of unwellness ( as disease entirely ) is a signifier of self-alienation, of false consciousnessâ⬠( Scheper-Hughes & A ; Lock 1986:138 ) .Covering with confusion and uncertainnessââ¬Å"The I in unwellness i s isolation, and the important letters in health are weâ⬠( Author Unknown ) . One Latin adage pronounces, ââ¬Å"illness shows us what we areâ⬠, this is seen in ethno-anatomical perceptual experiences, which give rich ethnographic stuff on the societal and cultural facets of being human, on wellness and ailment wellness, and on the societal experiences that we are believed to hold. ââ¬Å"The ways in which the organic structure is received and experienced in wellness and illness are, of class, extremely variableâ⬠( Scheper-Hughes & A ; Lock 1987:7 ) , which can be seen particularly in respects to autoimmune upsets where the organic structure is perceived to be assailing itself, it is a extremely individualized experience. Lupus is an crippling immunological upset, which is frequently hard to name, as there is no nonsubjective trial for it. It ââ¬Ës a disease that ââ¬Ës non-objective, changing in clip, and ill-defined. Illness in the context of a dislocation of the immune system enables it to suit all unwellnesss ; therefore, the unwellness is both an single unwellness, different for each individual, but besides corporate and a common syndrome. The immune system allows the explanatory system to finally flexible. The immune system besides was an overall account, warranting why it was that there are so adult male different unwellnesss and illness experiences. The immune system was damaged: with each individual reacting to this diminished immune system in different ways, stressing the singularity of the unwellness for each person. ââ¬Å"Human life can non be studied without taking into history both how persons are situated within and constrained by societal constructions and how those persons construct an apprehension of and enforce intending on the universe around themâ⬠( Dressler 2001:455 ) . Explanatory theoretical accounts of unwellness ( EM ) are a set of beliefs which provide people with ways of believing about manners of and theoretical accounts for world, they create order and significance ; this set of belie fs is constructed non by a civilization, but by persons ( Young 1982 ) . Illness can be seen as a procedure through which disease is given socially identifiable significances ( Crandon 1983, Young 1982, Foulks 1978 ) . For these grounds one of the chief concerns throughout fieldwork was the relationship between acquiring diagnosed and deriving societal legitimacy, as, frequently without this diagnosing people are at hazard of being denied the societal acknowledgment of being sick and accused of ââ¬Ëfaking it ââ¬Ë . One user relates her issues of merely desiring her diagnosing to go on: I ââ¬Ëm rather nervous of traveling to my physician and stating that I ââ¬Ëve seeking to self diagnose on the cyberspace because I know that ââ¬Ës non a good thing to make, but I merely want to cognize that I ââ¬Ëm non a hypochondriac or that I ââ¬Ëm non traveling huffy. Each clip I search yet another virus/pain/problem, the word lupus frequently appears. I go to my physicians normally to be told I ââ¬Ëm run down, I ââ¬Ëm down, my blood trials are by and large all right so nil to worry approximately. This accusal of forging it is felt among many sick persons ; and as a consequence on-line communicating becomes a utile tool in combating this accusal. Online forums are utilized as a soapbox, users take the clip to try to educate others in their experiences, and what was successful for them in the conflict for diagnosing. The usage of biomedical facts, the certification of unwellness symptoms that are seeable, and utilizations of diaries to document hurting are frequently sited as ways to derive entree to the socially acceptable ill function, to derive diagnosing. These tips, schemes, biomedical facts, and shared medical articles can be seen over and over once more in a assortment of forums. The hurting that is experienced by persons is influenced to a great extent by their personality, societal and cultural background, every bit good as the doctor-patient interaction ( Rudich et. al 2008 ) . I am ready for bed but wanted to post speedy with a update from my assignment todayâ⬠¦.for the biopsy he told me that he will non make a biopsy as they truly do non demo much OK, so I proceed to courteously dispute him and state him about The Lupus Site, my friends here, the narratives I have read about skin biopsy ââ¬Ës that clearly show a batch and are really helpful to help in diagnosing or at least aid to paint a clearer image. He did non like that really much and reminded me that in fact he was the M.D. , non me. â⬠¦So the lesson of the narrative here is I pissed off the physician today because he was merely a grandiloquent know it all who in my low sentiment did non make his occupation and disregarded the petitions of my Rheumy. When I got place I called my Rheumy and left a message for him to name me back and discourse this. I know that he will non be happy and the war between physicians will get down The obvious inanity of enduring from unwellness and the biomedical speculation of reason will be addressed in the context of long-run chronic unwellnesss, such as lupus. Bing rejected by physicians if one does n't suit into the ideal ill function is frequently a common experience, as one sick person here relates: Over the following twosome of hebdomads the lay waste toing giddiness and gesture illness returned ( which would subsequently go forth me incapable of driving a auto for over a month ) and I could n't even sit in a auto without acquiring ill. I told the following physician I was scared I had chronic EBV, and handed him my labs. He took one expression at them and threw them off. Literally, he threw them off in the rubbish can. He said, your EBV panel shows no active disease, but merely consequences of person who had mono in the yesteryear. This was the first clip I learned the lesson that physicians were n't ever rightâ⬠¦.the back of my head for so many old ages I knew my issues were acquiring worse and hated that the doctor ever merely dismissed it. Lupus sick persons ever start from a point of view of uncertainness, no 1 seems to recognize what is go oning, and many have non even heard of Lupus until official diagnosing. There is a clear cognition that something is non right with their organic structures, and their unwellness symptoms go a utile narrative when they come into contact with others who are sing the same issues. The oncoming of Lupus is frequently merely a list of symptoms to sick persons, a chronology of failures, and things that they can no longer do ; and it seems in many instances that these symptoms do non do sense, they are non cohesive or comprehendible. Explanations that are given to sick persons are frequently non satisfactory ; they are either discharged, or are still holding symptoms that they believe are non answered by the diagnosing given to them. Searching for an account, or merely to farther explain physicians ââ¬Ë accounts and readings, many stumble upon on-line forums. It can be seen as Kirmayer ( 2000 ) has shown, that the clinical state of affairs is based on the usage of medical linguistic communication, as parties, lupus sick persons and physicians, effort to convert the other of their unwellness. For many, this deficiency of certainty, populating with an unknown disease, or an undiagnosed unwellness led to different ways of research. Once on-line, and shoping through the forums on lupus, if they managed to happen them, many feel a sense of self-recognition. The narrations that are available online are unusually similar to their ain, and the experiences begin to do sense. As Kilshaw points out ââ¬Å"this minute can be seen as what Dilthey has referred to as an ââ¬Ëimpression point ââ¬Ë , a freshly inspired reading of one ââ¬Ës life reflecting a cardinal displacement in personal meaningâ⬠( Kilshaw 2004: 152 ) . Sufferers begin to see their unwellnesss as a medical issue, and no longer believe that it is a psychological upset ; they are armed with medical accounts to speak to their physicians about. This medicalization allows for a agency of assisting those enduring through the building of their ain personal narrations, which help to do sense out of what they are populating through. Forums can frequently take the signifier of a sick person naming off symptoms, to see if anyone else is sing the same issues. This can be seen many times over, and is illustrated by this user: I am enduring from widespread ahces/pains, some sever all chronic, utmost enfeebling weariness, encephalon fog attach toing address troubles, IBS, blood force per unit area runs on norm anyplace from 82/47-95/53, labs ever ââ¬Ëoff ââ¬Ë high sed, white cell up, ANA wonky, assorted peripheral neuropathes, eccentric toe/leg spasms, continueous chills/low basal organic structure temperature, fingers turn red/white sensitive and injury when cool, vision deteriorating, blurringâ⬠¦.This last, what I call ââ¬Ëflare ââ¬Ë , I had sudden onset high febrility, pleurisy, little white blisters on my fingers that eventually peeled, I work 12hr displacements and on my off yearss I literally slept round the clock and did perfectly nil elseâ⬠¦ nil, except preserve energy for my following tally at my jobâ⬠¦.I ââ¬Ëm sorry this has been so long. I do n't believe I ââ¬Ëve of all time sat down and set it on ââ¬Ëpaper ââ¬Ë before. I ââ¬Ëm non certain I wrote it all dow n, ya ââ¬Ëll cognize how that goes. I likely missed some stuff..my dry eyes, see..I keep thought of small things. I do n't believe it ââ¬Ës hypochondria? There is a barter of symptoms and they discuss the results of these, and ways to document and maintain path of the symptoms. As Kilshaw demonstrates, it is ââ¬Å"through duologue these individual events or experiences are linked together, held up and understood as pathologicalâ⬠( 2004: 153 ) ; the belief is no longer based on a psychological disease, something that is merely in their caput. The illness narrative provides coherency and legitimacy to the experience of the sick persons, the corporate action online orders and provides significance for the sick persons experiences of pandemonium and falling apart. And at the same clip, the person is supplying support for the corporate, as it is an add-on to the narrative. Lupus is a known status, although it is a obscure 1 that is highly difficult to name, which can in instances add a different dimension to the on-line narration. Because the trials are non conclusive, and many of the trials are non able to name the disease straight off the chiropteran, the narrations that are posted in the online forums frequently provide construction and weight to the unwellness. There are infinite stations in the forums that reading the on-line lists of symptoms, and on-line narrations of other sick persons provided more legitimacy to their cause, the fact that so many other people are traveling through what they are allows them to believe that it is n't a instance of ââ¬Å"faking itâ⬠. One adult female here relates her experience, including her symptoms, and societal jobs when combating with the disease: I ââ¬Ëm a 42 twelvemonth old adult female merely looking for hints and for person to state me I ââ¬Ëm non losing it. I may be manner off the grade here but I came across this site a piece ago while seeking the cyberspace in my effort to do sense of all my unwellnesss. Each clip I search yet another virus/pain/problem, the word lupus frequently appears. I go to my physicians normally to be told I ââ¬Ëm run down, I ââ¬Ëm down, my blood trials are by and large all right so nil to worry approximately. But this twelvemonth entirely I ââ¬Ëve had tonsillitis 4 times, 3 UTIs, thrush a just few times, otitis interna, a flu-like unwellness ( which I ââ¬Ëm still retrieving from ) , a HPV flair up and on top of that I have, and have had for ages, invariably bombinating ears, painful articulatio genuss, little dry sore spots of tegument with a big spot of something bumpy, flakey and scabby on the dorsum of my caput ( yuk ) . I besides have a thrombocyte map upset which was disco vered because I bruise easy and had really heavy periods, I ended up holding a hysterectomy because nil else worked. If I go farther back than this twelvemonth I ââ¬Ëve besides had things such as herpes zosters, pleurisy, vermilion febrility ( ! ) , glandular febrility and a big assortment of viral unwellnesss with no name. I have ungratified leg syndrome and I quite regularly get truly bad shoulder hurting in my left shoulder that lasts for hebdomads and injuries to take a breath even. I do take antidepressants because I do acquire depression but certainly all of my unwellnesss ca n't be because I ââ¬Ëm run down and depressed.I besides worry that my employers will finally lose forbearance with me. After reading people ââ¬Ës experiences on here I understand that what I ââ¬Ëm enduring is n't half every bit bad as what others live with, nevertheless does any of this sound familiar? Is it possible that all of my unwellnesss could be related and due to a status such as lupus? I ââ¬Ëm rather nervous of traveling to my physician and stating that I ââ¬Ëve seeking to self diagnose on the cyberspace because I know that ââ¬Ës non a good thing to make, but I merely want to cognize that I ââ¬Ëm non a hypochondriac or that I ââ¬Ëm non traveling mad. Adding to and imputing to the online Lupus narrative consequences in the single deriving an individuality and a community of people that they can associate to, it releases them from the isolation that is frequently felt when combating to acquire diagnosed. It provides a sense of coherence to the experience of pandemonium, through this duologue their single narrative becomes clearer to the sick person, it is legitimized. Although the disease is felt otherwise for each user, the narrations that are created online are consistent narrations, one that is able to integrate different necessities and experiences. Corporate sharing of information is one primary intent of a societal motion. These persons used to experience stray and entirely, they were confronting down the medical establishments that were built to assist ; they are now able to pull from the corporate online experience in order to assist them voyage these establishments.Contending for acknowledgmentPulling upon work done by Jos eph Dumit, Alan Young, and Susie Kilshaw, one can see how people are understanding, sing and utilizing their organic structures as opposition to the positivism of biomedicine. The squeeze of variable symptoms into unusually bantam bureaucratic holes requires run intoing the demands of 1s variableness into often-strict demands of the judgements of the experts. My current nurse practician scheduled me to see a nurse practician working at a Rheumatology office. My assignment included a history of symptoms, which at the clip were non that varied, but still included developing joint hurting, and even more increased weariness. I told her that I had a feeling it was Lupus, but I had no existent difficult grounds behind me except for one lab consequence, a bad memory of physicians assignment, and an internal inherent aptitude shouting the reply. The corporate sharing of personal narrations helped in the opposition of psychological incrimination and psychological responses. Because Lupus is such a enfeebling immunological upset, it is really hard to name ; this leads to psychological diagnosing ââ¬Ës, which can weaken the claim to the ill function, sick persons are invariably holding to work towards converting friends, household and coworkers that their unwellness is existent, legitimate and enfeebling. Bing able to carry through the ill function is of import to many people with Lupus, because there are frequently no codifications for their agony, no speedy diagnosing for their diseases, and no seeable complaints of the disease they are frequently subjected to judgements of forging and indolence. Trying to pull off and keep a ill function in society is near to impossible when 1 is being flatly denied being ill by the physicians that sick persons are seeing. There is a go throughing off of patients, from physician to sophis ticate as the Lupus sick person attempts to acquire diagnosing. Deriving entree to a diagnosing frequently gives the patient cogent evidence of agony, as psychological diagnosing weakens their claim to the ill function in society. One sick person relates the sum of physicians visited in their conflict for diagnosing: I saw my GP in June after several months of fatigue. By the clip I saw him a roseola had developed and I was holding shuddering febrilities at dark and had swollen secretory organs in my neckâ⬠¦.I was referred to a skin doctor who diagnosed urticarial vasculitisâ⬠¦.Since so I ââ¬Ëve been seeking different drug governments ; presently on loratidine, fexofenadine, Atarax and Zantac. After a class of steroids my tegument is great. I gave nevertheless developed hiting strivings at random topographic points, normally my custodies and pess, and intoxicant gives me febrility symptoms. My skin doctor has referred me to a rheumatologist and eye doctor ( my eyes on occasion show marks of uveitis ) . My GP has advised that in visible radiation of my symptoms and positive car antibodies ( DNA, Ro and La ) I about surely have SLE. One must account for unwellness under the biomedical system, and this requires go toing to both the ways in which the scientific facts are circulated and used, and the ways in which these same facts are used in societal experiences, how they are used, controlled, and subjugated. Dumit shows how through many doctor-patient interactions there is a comined consequence of discourse of disease to bring forth ââ¬Ësymbolic domination ââ¬Ë ; patients see this ââ¬Å"as a system in which they must ââ¬Ëprove ââ¬Ë their unwellness and their agony through mobilising factsâ⬠( 2005:577 ) . However, corporate wisdom of single experiences offers a powerful manner of opposition to this sort of power. When a physician can non call the unwellness after series of trials and scrutinies, many people come to believe of the patient as non truly being ill, and non truly enduring. This is a clear instance in Lupus, as it is both difficult to name, and has really few seeable symptoms. The hur ting that is felt is something that can non be seen, nevertheless it is frequently described as debilitating. And there are instances, that even if one does accomplish diagnosing of lupus through the physician, and therefore has legitimate entree to the ill function through that means, friends, household and colleagues for the sheer ground that it is non a seeable disease deny them entree. Following these denials, sick persons now have a tool chest that they can entree in the signifier of the online forums. There are set out letters that can be used to show the feelings and sentiments of Lupus sick persons, both a missive to household and friends that is vouched for, every bit good as a narrative called the Spoon Story. All these efforts at account and taking portion in the medical system is to accomplish some sense of proper function in society. The ill function has specific demands, and these demands are frequently capable to alter and use.Many sick persons have rejected their nor mal ego, as because they are inveterate sick, they have a immense desire to return to when they were healthy, being invariably denied the ill function in society has immense effects on their sense of individuality and ego. Many sick persons were busy persons, who held normal occupations, and have now become isolated from friends and household, many of whom doubt the unwellness. The undermentioned sick person relates to being ostracized by those who are close to her: Keeping it off paper saved me when I moved, changed occupations and needed to remake my insurance. Now I ââ¬Ëm in a different part, different rheumy [ sic ] and my status has deterioratedâ⬠¦ Now a diagnosing on paper would be a good thing! ! ! The ground for my sudden urgency in acquiring a diagnosing is my occupation. My concern is that mine is more of a CNS type because of the troubles I have with words/speech. I have a hold sometimes in my thought procedure and more and more in acquiring the connexion between acquiring the words to/from the encephalon to the oral cavity. I ââ¬Ëm non believing every bit rapidly as I need to. Part of my occupation is 911. I have to be able to think/speak or acquire a diagnosing explicating why I can non. Something that says it is merely an achings and strivings, can sit in my chair and still travel my oral cavity sort of unwellness is non gon na [ sic ] help the following shriek company I answerâ⬠¦.The worst thing is I feel so bad that I happening it difficult to acquire up to travel into work which is sad as I love my occupation. I was attracted to the sight because everyone seems so supportive and I could make with some of that right now because everyone keeps stating me I look so good now I have developed a roseola ââ¬â antecedently my face was pale. Therefore on-line communicating has several of import factors. First, the treatment groups are mentioning the media all the clip, it is one manner in which sick persons are maintaining each other informed to what is go oning in the populace sphere with their status. News articles, telecasting visual aspects, and current research documents are frequently cited and posted. This can be used to both rise consciousness, promote instruction about the disease, and as a utile forum to make statements in response to those articles that are n't suiting with the positions of those posting online. Second, the forum provides a safe oasis where self-depiction can take topographic point. Many sick persons of lupus are non all that easy to prosecute with face to face. They are excessively fast or excessively slow, excessively tired, agitated, pained or undependable. The Internet, with its asynchronism and bandwidth mediates this enormously leting fluid ââ¬Ënormal ââ¬Ë communicating to take top ographic point. Online postings are able to demo their feelings, and non hold the judgmental point of view of physicians, friends, and household ; depression is non merely something that is psychological to them, it is something that is from the unwellness that has attacked their really ability to execute in society. For many sick persons of this unwellness, a common subject of treatment on every bit good as off the cyberspace concerns how a sick person should near their physician, instructions are given on how to dress, how to move, what to convey, and what symptoms they should associate to the most. These instructions are frequently accompanied by what the physician might state in response, or what tests they so might order, and what tests a individual should be forcing for in the physicians office. The sick persons are taking control of the state of affairs, and pull stringsing physicians into diagnosing ; but it has besides been seen that although physicians are inquiring inquir ies and giving responses, they are inquiring inquiries that elicit a response that the physician believes is right ( Dumit 2006 ) . The use of the clinical brush can be seen as walking a thin line, as if one does non make the portion convincingly plenty, they can be accused once more of forging it, of moving ailment ; nevertheless if they do non, there is a opportunity that they might non be considered sick at all. Therefore ââ¬Å"their lone pick is to feign to be who they really are, in the establishment ââ¬Ës position. They must work at ââ¬Ëachieving appropriate visual aspect ââ¬Ë and ââ¬Ëlook and act sick'â⬠( Dumit 2006: 586 ) . Sick persons frequently experience Lupus, as a contested disease, in the signifier of societal exclusion. Since the disease is so difficult to name, there is frequently a deficiency of attention and support for those with it. They deal with this uncertainness by giving the unwellness facts that they see on-line, and they frame them in medical footings, in order to extinguish this uncertainness and societal exclusion. The attendant treatments form the footing of changeless experimentation with schemes, tactics, individualities and relationships. They besides form treatments on the expected alternate therapies, referrals, and supply a topographic point for emotional support. The Internet, with its asynchronism and bandwidth mediates issues of being sick enormously, it allows those that are sick to move normal, and allows for an easy signifier of communicating. The issues that are addressed and the resources provided to the sick persons online provide the footing for the webs of little groups, and larger cyberspace communities, and allows for covering with mass media, in order to do life more liveable for sick persons. The Internet provides a community and offers alternate personal narrations, and schemes for lasting, giving emotional support to those that are in demand.
Sunday, September 29, 2019
Application of Simulation Technique in Queuing Model for ATM Facility Essay
1.0 Issues/ Problem Statement: Most of the ATMs have the problem of long queue of customers to undergo simple transaction at the peak hours and remain idle due to the lack of customer entry at the off peak hours. 2.0 Objectives: 1. To develop a simulation model to reduce the waiting time of customers and the total operation cost related to ATM installation. 2. To determine whether only one machine is required to fulfill the need or two more machines are needed to be installed to give comfort to customers who are really of short period of time. 3. To develop an efficient procedure for ATM queuing problem 3.0 Literature Review: Apart from ATM problem, simulation with queuing model had been used for various applications too: According to Pieter Tjerk de Boer (1983), substantial focus has been dedicated to the estimation of overflow probabilities in queuing networks. A different adaptive method has applied to queuing problems than in the present work with few simple models been considered.The article of S. S. Lavenberg(1989) has discussed that simulation is feasible for statistically studying a complex queuing model. Moderate simulation durations are found to be sufficient to obtain precise confidence interval estimates. As current configuration at each step of savings or insertion procedures is possibly infeasible, thus the alternative configuration is one that yields the largest savings in some criterion functions with these procedures can be found in Clarke and Wright (1964) or in Solomon (1987). Christofides et al (1981) has discussed Lagrangean relaxation procedures for the queuing of customer in front of ATM. Interactive optimization is incorporated into the problem-solving process with adaptations of this approach to queuing are presented by Krolak et al (1970). Brame and SimchiLevi (1995) has illustrated simulation model is worked by initially introducing the location based heuristic for general queuing problem as a location problem which is solved subsequently and the solution is transformed into solution to the queuing problem. 4.0 Methodology: Simulation technique in queuing model is used for solving ATM waiting time problem since this problem cannot be solved with mathematical techniques and physical experimentation. Simulation technique helps identifying the pitfalls of existing 3 ATM services of 3 different banks at VIT (Vellore Institute of Technology). Initially, the simulation is being applied to see the rate of entry and exit, the waiting time of a customer with the ATM machineââ¬â¢s idle time after observation of the similar and continuous trend on weekdays and weekends separately. The next step i.e. utilize queuing model to examine the number of customers in the system to the customers wait before being served, thereby it proposes a new ATM service from any of these banks or other than the existing banks based upon the service required from the customers. A suitable simulation technique is also formulated to reduce idle time of servers and waiting time of customers for any bank having ATM facility. 5.0 Findings: The overall result shows the comparison between the three banks based on several characteristic, by applying mathematical formula, the simulation technique and queuing theory. From the simulation result, Indian Bank weekend has the lowest expected time customer spends in the system, 80; whereas Indian Bank weekdays free and Centurion bank have the highest in expected time customer spends in the system that is 120. Apart from that, the result also shows Indian Bank weekdays free and Centurion Bank has the 0 time for the customer expected to wait, whereas SBI weekend has the highest expected waiting time per customer, 12. From the queuing result, Centurion Bank has the lowest expected time customer spend in the system that is 189, whereas Indian Bank weekdays free, SBI weekdays free and SBI weekend has showed the highest, 250. For the expected waiting time per customer, Centurion Bank has showed the lowest 69, whereas SBI weekend with the highest result, 159. 6.0 Discussions: By taking one day as a standard, a heavy crowd is found in prime hours during the weekdays in Indian Bank and SBI ATMs, the equipment ATM is 100% utilized by the customers. Utilization factor for Indian Bank and SBI in the non-busy hours is 50% and 55% respectively. In weekend period, the utilization factor for Indian Bank and SBI is 62% and 64% respectively. The reason shows that the SBI has obtained the highest utilization factor among the other 2 banks is because of the customers do not face the ââ¬Å"Out of Service Problemâ⬠which is frequently occurred in Indian Bank and Centurion Bank, with an average of two times in a week. However, it takes more time to reload the currency in the ATM machine than Indian Bank in SBI. Few customers have the ATM transaction with Centurion Bank because of the dissatisfaction on its customer service and the minimum number of branches throughout the India. In addition, from the tabulate results, SBI ATM has obtained the minimum Ws and Wq than the other two banks which imply that it has attained the customer satisfaction on its services. 7.0 Recommendations: Every aspect that has an effect on making the waiting time longer in the ATM should be taken into the consideration. The aspects like the people that are not well versed with ATM, customers who have stand in the queue and leave, the time the workers take to feed the ATM with currency, out of stock situation and holidays which mostly after exams the utility of ATM should be taken into account of the waiting problem. Another recommendation is the sample size should be extended into larger sample size and more days of observation to obtain more accurate results. In addition, the consideration of waiting cost and service cost can help developing an efficient procedure for ATM queuing problem and to find out the best ATM facility. 8.0 Conclusion: Queuing Model and Simulation Model(SM) are used to define the queuing problems in terms of decision making to reduce the customerââ¬â¢s waiting time. After comparing the customersââ¬â¢ behaviour on different TM service at VIT, a new ATM machine (SBI) should be installed in menââ¬â¢s hostel to facilitate more customers towards the service by reducing the customers cost and service cost for the long runââ¬â¢s benefit. 9.0 Personal Comment/ opinion: In the last ten years, simulation software and methodology has been developed and used in the bank services. The previous sections have shown that using the simulation technique can increase sustainability of a bank with better customer service and enhanced customer satisfaction. However, this simulation technique is not limited only in modeling the customer in a bank, but the same concept can also be applied in defining and analyzing the model of a system or problem in the banking areas. Other areas can be modeled in banking areas such as customer flows to evaluate alternative layout within a branch bank, cash flows between branches and the bankââ¬â¢s central office. Once these models developed, it can easily be used to examine the effect of different parameters on the variables in the model.
Friday, September 27, 2019
The Strategic Human Resources Management Model and Its Effects Research Paper
The Strategic Human Resources Management Model and Its Effects - Research Paper Example The Personnel Department acts as a meditation centre where arguments, complaints or concerns are settled. They have the rewards and punishment control over the actions of the employees based on their policy regulation function. The evaluation or appraisal function is also a part of the Departmentââ¬â¢s responsibility. The appraisal process is very important to this department because this is where they get inputs from both the manager and the employee or subordinate regarding the work attitudes and procedures, which they then use to formulate ate development plans. The Department also takes care of the processes for retirement and termination of employment with the company. Looking at all the functions of the Personnel Department, it is clearly shown that the main or primary job of this Department is to maintain order. Generally, the order may mean upholding the policies of the company by closely monitoring and checking the employeesââ¬â¢ actions, but there are other meanings a ttached to the maintenance of order. This order may be in terms of relationships or the lack of it among colleagues or between a superior and a subordinate. This order may also be in the form of addressing the manpower needs of each department so they can function well to achieve company goals. This also may take the form of appeasing the concerns or complaints of the employees to maintain peace. The order may also refer to the continuous development of the staff through training to increase productivity. It may also mean the timely and appropriate response to questions relating to job functions and personal privileges or rights.
How over expansion and militarism led to the fall of Rome Essay
How over expansion and militarism led to the fall of Rome - Essay Example The term Roman Empire referred to a period in the history of Ancient when Rome, as well as its territories, ware ruled by tyrannical Emperors. The empire is believed to have lasted from 27 BC-475 AD, a period believed to be more than 500 years. During this era, the Roman Empire was very powerful and had territories covering south and west Europe, land around the Mediterranean Sea, Britain, North African and Asia Minor(Goldsworthy, 2009a). From the mentioned continents, it is evident that Roman Empire had widened its boundaries extensively. However, its expansionism strategies were diminished by its fall. Though this may be one of the features that led to the fall of Roman Empire, there are also other major factors that contributed to the same (Gibbon, & Bury, 1946). According to Gibbon (1932) and Goldsworthy (2009b), events took place in a chronological manner, and therefore, one cannot say that there was no order in which these factors occurred over the period of about five hundred years. The five hundred years that took place before the rise and fall of Rome Empire were accompanied by many factors that resulted in its decline. The major causes of Roman Empireââ¬â¢s decline can be detailed as follows: Antagonism between the Senate and the Emperor Political Corruption and the Praetorian Guard Decline in Morals Constant Wars and Heavy Military Spending Barbarianââ¬â¢s Knowledge of Roman Military Tactics The 'Mob' and the value of the 'Games' ... the 'Games' Decline in Ethics and Values Fast expansion of the Empire Unemployment of the Working Classes (The Plebs) Failing Economy Christianity Barbarian Invasion Natural Disasters and slave labor Antagonism between the Senate and the Emperor As in examples above, antagonism between the senate and the Emperor could be counted as one of the major causes of the collapse of the Rome Empire. At this time, the legal powers to rule the Romeââ¬â¢s religious, the civil and military associations were under the emperor while the senate acted as an advisory body. Though the two bodies were meant to act together, things never worked as their relationship began to change (Perkins, 2005). The emperor had no authority over life and death. The two bodies started taking different directions as the authoritative and affluent roman Emperors unavoidably become corrupted and lived a dishonest, deceptive and dishonest lifestyle (Parsons, 2010). As a result of this, Roman Empire experienced a lot of opposition between the Emperors and the Senators. In his case, everybody saw each other as the most corrupt, viewed each other as enemies and as enmity persisted, poor leadership set in resulting in the collapse of the empire (Nardo, 2001). Constant Wars and Heavy Military Spending This being one of the results of the fall of Roman Empire, constant war played a vital role in its fall. Since the empire was growing at a rapid pace, it needed more soldiers for it to survive a great conqueror. In this case, constant fighting needed heavy military spending. This demand for the military was high since the Roman Empire became over stretched, and the need for more solders was proportional to its obligations for expansion and protection of their overstretched territories (Fagan & Stonebarger, 1999). Due
Thursday, September 26, 2019
Essay problem-solution Example | Topics and Well Written Essays - 500 words
Problem-solution - Essay Example Global warming is led to by many causes. The rise in the carbon dioxide content is the most principle cause for this phenomenon. Industrialization is one of the most important reasons for carbon dioxide release into the atmosphere. The release of carbon dioxide from the fossil fuels that are used in these industries leads to an increase in the carbon dioxide levels in the air. Automobiles are another source of the emission of carbon dioxide in the air. The trees work as a shield against the issue of global warming as they take in the carbon dioxide from the air and release in return. Deforestation for industrialization and forest fires are thus another major cause of global warming as they lead to a reduction in the number of trees and thus this promotes the warming phenomenon of Earth. Global warming has brought with it many disastrous effects on the atmosphere and the environment. The warming results in an increase in the overall temperature of the world. This promotes the melting of the glaciers which are the ice reserves which in turn leads to an increase in the level of water in the rivers and the seas. A rise in the overall water level can be cause of floods and many small islands can be destroyed from the world map owing to this. Furthermore, floods are also a cause of the spread of diseases. Heat waves are also generated owing to the warming of the earth. These heat waves can be a reason of many deaths as well. Thus, global warming provides for many damaging results for the earthââ¬â¢s atmosphere as well as for mankind. The issue of global warming should be taken seriously and steps should be taken on the global level to prevent further deterioration. The emission of greenhouse gases should be controlled. Alternative fuels should be introduced for the motor vehicles to prevent the emission of gases. The usage of public transport should be promoted to reduce the emission of carbon dioxide. Guidelines for industries should also be laid down which may
Wednesday, September 25, 2019
Division of Time table Essay Example | Topics and Well Written Essays - 750 words
Division of Time table - Essay Example 300 min/wk General Science Biology Chemistry History & Social Studies 750 min/wk 750 min/wk 750 min/wk History Eastern History Western History Arts 100 min/wk 100 min/wk 200 min/wk Music Traditional Music Regional Music Humanities Livelihood 100 min/wk 100 min/wk 100 min/wk Home Economics Work Education Entrepreneurship Technology Integrated w/ above 100 min/wk 100 min/wk Computers Internet & Website Design, Computer Game Development Animation Health & Physical Education 100 min/wk 100 min/wk 100 min/wk Sports - Swimming Sports - Volleyball Sports - Basketball, Soccer Values 100 min/wk 100 min/wk 100 min/wk Values Values Values Explanation of Curriculum According to the U.S. Department of Education (2008), the No Child Left Behind Act of 2001 is an act to "close the achievement gap with accountability, flexibility, and choice, so that no child is left behind" It includes important provisions which specifically address mathematics, reading and language arts, and science, at the very least. As such different states have formulated their own academic standards to comply with the No Child Left Behind Act. In the Pennsylvania Code (2008), planned instruction for every year for K-2nd grade should include language arts, integrating reading, writing, phonics, spelling, listening, speaking, literature and grammar, and information management, including library skills; mathematics, including problem-solving and computation skills; science and technology education, involving active learning experiences for students; environment and ecology education, involving active learning experiences for students; social studies with civics and government, economics, geography and history; health, safety and physical education, including instruction in concepts and... afety and physical education, including instruction in concepts and skills which affect personal, family and community health and safety, nutrition, the prevention of alcohol, chemical and tobacco abuse, knowledge and practice of lifetime physical activities, personal fitness, basic movement skills and concepts, motor skill development, principles and strategies of movement, and safety practices in physical activity settings; the arts, including active learning experiences in art, music, dance and theatre. Planned instruction for 3rd to 5th grade shall include all the previously stated learning areas for K to 2nd grade, with the addition of instruction about agriculture and agricultural science within the science and technology and environment and ecology learning areas; and the understanding and use of library and other information sources.
Tuesday, September 24, 2019
Evaluate the implications for the maritime component of the likely Essay
Evaluate the implications for the maritime component of the likely characteristics of future conflict - Essay Example The Cold War was precipitated by the bipolarity that prevailed during the rivalry of the United States and the Soviet Union for influence and power. In studying the causes for these major conflicts, one will see their marked differences. Chester Crocker, Fen Osler Hampson and Pamela Aall have argued that any theories about war must reject that it is constant or at least must be modified to include many variables that explain observed variation.1 In talking about future war, it is, hence, difficult to predict. But history, after numerous wars, and the current military, political and economic trends have equipped us with enough knowledge to understand what will characterize the future conflicts and how they will affect the their components today onwards. The significance of this kind of analysis and discourse is that, as we sufficiently understand the political, economic and social circumstances that lie behind the decisions for violent actions, we are in a better position not just to be ready but also to utilize the knowledge for use in conflict prevention. More importantly, it underscores the reality that war remains primarily a tool of politics in the hands of willful leaders. For this paper, I will explore several variables of future conflict that is affecting and will affect the maritime forces including: the actors in conflict both state and non-state entities; the nature of future war; inter-state warfare; the changing nature of future threat; the changing roles and missions that future conflict may require of maritime forces; the effect of the new roles and responsibilities that are required by future conflict on maritime forces; and, how the asymmetric warfare looks like at sea. The numerous wars that the world has seen have different characteristics in regard to scale, period, casualties, among other characteristics. It varies in form (interstate, intrastate), regional concentration, frequency, intensity, and other
Monday, September 23, 2019
Recruitment Memorandum Essay Example | Topics and Well Written Essays - 750 words
Recruitment Memorandum - Essay Example A great majority of the fire fighters are male and white, mainly with an Italian or Irish descent. The recruitment process did not favor the minorities who had poor quality education; they were usually given essay-based tests, which they performed poorly. Another flaw that was evident in the process was insufficient advertising for the available positions; it was usually done through a word of mouth through the preexisting staff. Various aspects of the recruitment process presented lack of credibility in the recruitment process. Firstly, racial discrimination is quite evident; it is ethical and legal to give all people a fair chance in a recruitment process. However, even if the minority group is incapable of competing effectively with the dominant race, special provisions should be set for them. The current situation in the firefighting department demonstrates racism of high order. This may mean that the unrepresented races may feel insecure and may have no confidence with the services offered by the department. Secondly, the gender discrimination is a major issue that requires attention. The view that almost all the employees are male creates an impression that women are incapable of firefighting, which is not true. A special consideration should be made to incorporate women especially in areas that do not involve much use of muscle power. Thirdly, the administration of exams as the only selection criteria does not meet the threshold of identify who can serve the firefighting department best, other strategies are required. Finally, the advertisement of the vacancies is not well done. When it is only done through the word of mouth, it means a limited group of people will get the opportunity to get the information. It is obvious that the most targeted will be the relatives and friends to the existing staff members. Ã
Sunday, September 22, 2019
Indigenous peoples in Australia Essay Example for Free
Indigenous peoples in Australia Essay Indigenous Peoples of Australia is categorized into two groups namely, the Aboriginal People and the Torres Strait Islanders (Sharp). Aboriginal peoples are said to be the group of IPââ¬â¢s, who became the first settlers in mainland Australia. The Torres Strait Islanders are the ones who are originally the inhabitants of the region between Australia and New Guinea. Indigenous Australians include a very diverse communities and societies across the whole Australia. Studies and researches show that there is an approximately 200 languages that are native to the Indigenous Australians and 20 of these languages are still being spoken up to now in Australia (Sharp). The majority of the Indigenous Australians resides in the south east near the Murray River. Indigenous Peoples in South Africa The African region has been termed as home for the majority of indigenous peoples (Clark). North and South Africa are comprised of indigenous communities which are also divided into several subgroups. Though hunting, gathering and pastoral means are the most basic means used by the indigenous peoples in Africa, some indigenous communities have already learned the agricultural system. As mentioned, the diverse indigenous communities in both North and South Africa are grouped not on the basis of their chronological subsistence but on the basis of their common characteristics in terms of cultural inclinations and lifestyle. Mining Operations in Australia and South Africa South Africa and Australia rank second and third respectively as the worldââ¬â¢s top producers of gold (Indigenous Community Organisations and Miners, 2007). While gold is the second outstanding export product of Australia, it is the biggest export product of South Africa. It is undeniable that mining in both Australia and South Africa helps the two in advancing and maintaining good economic standings. However, other issues like human rights violations have been reportedly committed because of the mining operations in South Africa and Australia. On the other hand, South Africa and Australia have different cases in terms of the developments regarding the alleviation of human rights violations through mining operations. In Australia, the government devises a strategic approach which aims to reconcile the mining companies and the indigenous peoples (The Mining Ombudsman, 2007). As part of the Corporate Social Responsibility of the mining companies, they are obligated by the law to come up with humanitarian programs that which are directed towards the promotion of the welfare of the indigenous peoples in Australia. Mining companies conducted seminars, conferences and workshops that which enables the indigenous peoples know how mining projects operate and how could they help the indigenous peoples improve their everyday living. Through these programs and projects, the rights of the Indigenous Australians are being upheld in such a way that they are set towards progress and development together with the mining corporations. However, in the case of the mining operations in South Africa, there is a lack of consideration given to the indigenous peoples. The mining companies in South Africa have been reportedly accused of exploiting the natural resources within the habitats of the indigenous peoples in South Africa (Communities take shine off, 2006). Environmental degradation, displacement of the indigenous peoples from their residences, and health hazards brought about by the mining operations are among the issues raised by the indigenous communities (Communities take shine off, 2006). Their rights as people are being neglected in such way that the mining activities cause harm on their part. Many forests are deforested and the wild life is severely threatened. It is to be noted that most of the indigenous peoples in South Africa live on uplands as well as near forests. The destruction of these forests signals the destruction of their homes too. Thus, in order to safeguard their rights for these natural resources (as their homes and source of food and others), protection and preservation of the environment should also be considered by the government as well as the mining corporations. In addition, there is also a treat to the health of the indigenous peoples caused by the toxic and other wastes products that are being secreted during mining activities (Communities take shine off, 2006). Water contamination and lead poisoning are some of the health hazards that are caused by mining. Lastly, cultural degradation is also said to occur in indigenous communities because mining devastates certain sites which are sacred and ceremonial for the indigenous peoples. Conclusion Though, mining serves the economic growth of Australia and South Africa, it does not change the fact that it brings certain disadvantages towards the people particularly on the indigenous peoples. The main difference between the impact of the mining operations on the indigenous communities in Australia and South Africa is that in Australia the government and the mining companies are aware of the fact that they should consider the well-being of the indigenous peoples whereas in South Africa the government and the mining corporations lacks awareness and cooperation to resolve the conflict between the indigenous peoples and the mining operations. Works Cited Maybury-Lewis, David. Indigenous Peoples, Ethnic Groups, and the State. Second ed. Allyn and Bacon, 2001. Sharp, Anne. Indigenous Peoples of the World ââ¬â Australia. First ed. Lucent Books, 2002. Clark, Domini. South Africa the People. Crabtree Publishing Company, 1999. ââ¬Å"The Mining Ombudsman. â⬠2007. Oxfam Australia. 09 November 2007 http://www. oxfam. org. au/campaigns/mining/ombudsman/. ââ¬Å"Indigenous Community Organisations and Miners: Partnering Sustainable Regional Development. â⬠14 February 2007. The Australian National University. 09 November 2007 http://www. anu. edu. au/caepr/mining. php. ââ¬Å"Communities take shine off platinum players in South Africas Bushveld. â⬠19 May 2006. Mines and Communities. 09 November 2007 http://www. minesandcommunities. org/Action/press1099. htm.
Saturday, September 21, 2019
The Kite Tunner Essay Example for Free
The Kite Tunner Essay In The Kite Runner, even though Hassan remains loyal, forgiving, and good natured, he is still the character who suffers the most. Hassan is a character who is discriminated against from the start of the book, till the very end. He is a part of a poor ethnic group called Hazaras whom are considered victims in the Afghan society. Amir and Hassan are half brothers, but because Hassan was a Hazara, he grew up in a hut as a servant working for his own father. Hassan understands his inferiority and accepts it, which causes other people to take advantage of him by betraying him. For example, even though Hassan always stood up for Amir, Amir left Hassan to get raped. Hassan was too scared to stand up for his best friend and believed that Hassan is sacrificing himself for Amir. Not only was the rape an attack physically, but it is also an attack on the victimââ¬â¢s emotions and dignity. In the Kite Runner, Hassan suffers the most pain both physically and mentally by living his life being betrayed, discriminated and losing his family. To start off, Hassan is a poor ethnic Hazara, he is considered inferior to the Afghan society, and therefore is discriminated throughout the whole novel. For example, Hassan and Amir both have the same rich father, but because Hassan was illegitimate and was a Hazara, he grew up as a servant in his fatherââ¬â¢s hut. With this in mind, Hassan is discriminated by everyone even his own family even the ones who Hassam didnââ¬â¢t even know was his family. Discrimination is so significant in his life that he has accepted the fact that he was born to be hated for his appearance. Hassanââ¬â¢s biological father Baba lies to Hassan and doesnââ¬â¢t even tell him that he is his real father. Despite the fact that Hassan gets discriminated upon, he still remains loyal and forgiving. Another example would be when the Taliban wanted Babaââ¬â¢s house and when they found out that Hassan and his wife were kuvubg u but alone, they wouldnââ¬â¢t listen to him when he tried to explain that Rahim Khan was the owner and they were waiting his return. The Taliban of course shot Hassan and his wife leaving Sohrab alone. The Taliban who show Hassan and his Wife were dismissed from their trial because they said it was self defence. They were dismissed because they have no proof that the Hazaras attacked the Taliban because no one would stand up for Hazaras. With this in mind, Hassan has died In addition, despite the fact that everyone knows that Hassan is good natured, he still is betrayed many times in the story mostly by his best friend Amir. In detail, Amir treats Hassan unfairly even thought he knows that Hassan will be good about it. For example, Amir left Hassan to get raped by Assef in the alley Hassan taught him incorrect meaning of words. Even after Amir betrays Amir, Hassan continues to serve him. and abandoning him even though Hassan saved him countless amounts of time. Amir only does this because When Assef asked Amir why heââ¬â¢s friends with a Hazara, Amir said that heââ¬â¢s his servant and nothing more. Amir didnââ¬â¢t know that Hassan was his half brother, which leads Amir to take advantage of Hassan. Rape is one of the events in the story that happens to Hassan that makes him suffer the most. In this story, rape is not just physically violent, but it is also an attack on the victimââ¬â¢s emotions and dignity. The fact that Hassan didnââ¬â¢t resist just proves his role in society and how he accepts punishment that is given upon him. The rape proves that he doesnââ¬â¢t care about his own suffering Lastly, Hassan suffers by losing the people who were once family to him. Hassan suffers because his half brother Amir is the reason why Hassan and Ali left the house. In fact, Hassan has it tougher than Amir from the beginning. Not only did he lose his mother, his mother rejected him at birth. Sanaubar had taken one glance at the baby in Alis arms, seen the cleft lip, and barked a bitter laughter. [ ]. She had refused to even hold Hassan, and just five days later she was gone. (29). This event has left Hassan motherless ever since birth. He is separated from his beloved Amir and Baba whom he spent his whole life with. Another example would be when his mother left and rejected him at birth.
Friday, September 20, 2019
Comparison of Techniques for Diagnosis of Multiple Sclerosis
Comparison of Techniques for Diagnosis of Multiple Sclerosis Background: There is increased need to develop specific biomarkers for multiple sclerosis (MS) to aid in the diagnosis, improve the management of patients and the monitoring of the effectiveness of treatment. Oligoadenylate synthetase 1 (OAS1) is up regulated by type 1 interferon. A single nucleotide polymorphism (SNP) in exon 7 of OAS1 results in differential enzyme activity. Objective: To correlate different OAS1 genotypes, in patients with relapsing remitting multiple scleroses (RRMS) under interferon-beta (IFN à ²) therapy, with disease activity. Subjects and Methods: OAS1 genotype was assessed in 20 patients with RRMS and 20 age and gender matched healthy controls. All patients were medicated with IFN à ². The patients were subdivided in terms of disease activity assessed by Expanded Disability Status Scale (EDSS), in two groups; group I with minimal disease activity and group II with severely active disease. All patients were followed up every 6 months for a period of 2 years . Results: Genotyping analysis of the OAS1 gene revealed a significant difference between RRMS patients and control group, with lower frequency of GG in patients (25%) compared to controls (65 %) (p = 0.0001). Furthermore, AA genotype was detected 35% of patients compared to 0% in controls (p = 0.01). Regarding disease activity, AA genotype had a significantly higher frequency (71.4%) in patients with severely active disease compared to 15.4% in patients with minimally active disease (p=0.0001). Conclusions: The A-allele is considered risky and the G is protective, so those with the AA genotype in particular should be carefully monitored for evidence of disease activity. Conversely, GG genotype may protect against increased disease activity. Introduction Multiple sclerosis (MS) is an inflammatory demyelinating disease of the central nervous system, the etiology and pathogenesis of which remain largely elusive. The most common form of MS is the relapsingââ¬âremitting form (RRMS), in which episodes of acute worsening of neurological function (relapses) are followed by partial or complete recovery periods (remissions) free of disease progression.1,2 Type 1 interferons (IFNs) are innate immune cytokins that activate the JAK/Stat signaling pathway leading to induction of IFN-stimulated genes. The 2,5-OAS family is central to the IFN antiviral pathway for viruses whose replication includes production of double-stranded RNA. One member of this family of proteins, OAS1, induces RNAseL, resulting in degradation of viral RNA, inhibition of virus replication, and promotion of cellular apoptosis.1 Several OAS1 polymorphisms have been reported; one located at the exon 7 splice-acceptor site results in alternative splicing of the OAS1 mRNA. Although clinical trials have proven the efficacy of interferon-beta (IFN à ²) in the treatment of RRMS2-4, over one-third of patients have continuing significant disease activity.5 On purely clinical grounds, patients have variously been considered to have responded poorly, based on relapse occurrence6-9 or on disability progression while receiving IFN à ² therapy.10 Therefore, cohorts of patients receiving IFN à ² can be informative for evaluating general determinants of disease activity. Aim of work: to examine the relationship between OAS1 genotype and indices of disease activity in RRMS under IFN à ² therapy. Subjects and Methods Twenty patients with RRMS according to revised McDonald criteria11 were enrolled from an outpatient and inpatient population attending Neurology Department, Tanta University Hospital. Twenty unrelated age- and gender-matched volunteers, with no history of MS or other neurologic disease, were recruited as a control group. All patients received IFNà ² therapy and followed up every 6 months over a period of 2 years from January 2010 to January 2012. The Ethics Committee of Hospital approved the study, and a written informed consent was obtained from each participant. For all patients, baseline data collected included disease duration, age at onset, relapse history prior to therapy, and clinical disability measured using the Expanded Disability Status Scale (EDSS).12 Relapses were defined as an episode of neurologic disturbance lasting for at least 24 hours and not caused by a change in core body temperature or infection.13 Disability progression was defined as an increase in EDSS score by 1 point from baseline confirmed at 6 months.5 Genomic DNA was isolated from peripheral blood samples. Primers were designed to specifically amplify a 347-bp product surrounding the rs10774671 SNP. A total of 5 grams of genomic DNA was amplified by PCR. Primer sequences used were; rs 10774671 ââ¬â forward, TCCAGATGGCATGTCACAGT and reverse, AGAAGGCCAGGAGTCAGGA. Amplification conditions included initial denaturation at 94 centigrade for 2 minutes, followed by 28 cycles at 94 centigrade for 20 seconds, 62 centigrade for 40 seconds 72 centigrade for 30 seconds, with a final extension for 7 minutes at 72 centigrade. The PCR products were digested with the ALU1 restriction enzyme. Digested products were analyzed by agrose gel electrophoresis and genotypes were assigned, the A-allele coding for a truncated form with low activity and the G conferring high enzymatic activity. Patients were assigned to 1 of 2 groups. Group I included minimal disease activity; patients who experienced a maximum of 1 relapse after 24 months of IFNà ² therapy and had no sustained disability progression. Group II included a severely active disease; patients who had 2 or more relapses on IFNà ² therapy over 24 months with or without sustained disability progression.14 Statistical Analysis SPSS 10 was used for data analysis.15 P value
Thursday, September 19, 2019
Patient Falls and Medication Errors Essay example -- Health Care, Pati
Issue/Problem of Interest Falls are the second most common adverse event within health care institutions following medication errors, and an estimated 30% of hospital-based falls result in serious injury. The severity of this problem led the Joint Commission to make reducing the risk of patient injuries from falls a national patient safety goal for hospitals in 2009 (AHRQ, 2006). Falls are a leading cause of hospital-acquired injury and frequently prolong and complicate hospital stays and result in poor quality of life, increased costs, and unanticipated admissions to long-term care facilities. Changes in health care financing in the 1990s were accompanied by a variety of cost-cutting measures in hospitals across the United States. Common cost-cutting strategies included reducing the total number of nursing hours per patient day and reducing the percentage of hours supplied by registered nurses (RNs), the most highly paid group. The reduction in staffing led to widespread concern that patient care in acute care settings would suffer. In response to concerns about staffing and quality of care, the American Nurses Association (ANA) launched the Patient Safety and Nursing Quality Initiatives in 1994 to address the impact of health care restructuring on patient care and nursing. To facilitate the initiative, ANA established the National Database of Nursing Quality Indicators (NDNQI) in 1997, with two goals: (1) to develop a database that would support empirical monitoring of the impact of nurse staffing on patient safety and quality of care across the nation, and (2) to provide individual hospitals with a quality improvement tool that includes national comparisons of nurse staffing and patient outcomes with similar hospi... ...al adverse incidents, depending on the patient population studied (Hitcho, 2004). The rates vary from 1.9 up to 18.4 falls per 1,000 patient days depending on organization type, and according to a study by the National Council on Aging, 30% of these incidences result in serious injury (Stevens, 2004). Another significant consequence of falls is that they are expensive and contribute to the increasing health care expenditure. An estimate of the average DRG payment for injuries sustained by a patient falling is $25, 643 (Hart, Chen, Rashidee, and Sanjaya, 2009). This is significant in that with the developing atmosphere of pay-for-performance, initiated by CMS, hospitals now have a major monetary stake in reducing the number of fall-related injuries. The CDC estimates that the cost of fall injuries will exceed $23 billion within the next few years (Tzeng, 2008). Patient Falls and Medication Errors Essay example -- Health Care, Pati Issue/Problem of Interest Falls are the second most common adverse event within health care institutions following medication errors, and an estimated 30% of hospital-based falls result in serious injury. The severity of this problem led the Joint Commission to make reducing the risk of patient injuries from falls a national patient safety goal for hospitals in 2009 (AHRQ, 2006). Falls are a leading cause of hospital-acquired injury and frequently prolong and complicate hospital stays and result in poor quality of life, increased costs, and unanticipated admissions to long-term care facilities. Changes in health care financing in the 1990s were accompanied by a variety of cost-cutting measures in hospitals across the United States. Common cost-cutting strategies included reducing the total number of nursing hours per patient day and reducing the percentage of hours supplied by registered nurses (RNs), the most highly paid group. The reduction in staffing led to widespread concern that patient care in acute care settings would suffer. In response to concerns about staffing and quality of care, the American Nurses Association (ANA) launched the Patient Safety and Nursing Quality Initiatives in 1994 to address the impact of health care restructuring on patient care and nursing. To facilitate the initiative, ANA established the National Database of Nursing Quality Indicators (NDNQI) in 1997, with two goals: (1) to develop a database that would support empirical monitoring of the impact of nurse staffing on patient safety and quality of care across the nation, and (2) to provide individual hospitals with a quality improvement tool that includes national comparisons of nurse staffing and patient outcomes with similar hospi... ...al adverse incidents, depending on the patient population studied (Hitcho, 2004). The rates vary from 1.9 up to 18.4 falls per 1,000 patient days depending on organization type, and according to a study by the National Council on Aging, 30% of these incidences result in serious injury (Stevens, 2004). Another significant consequence of falls is that they are expensive and contribute to the increasing health care expenditure. An estimate of the average DRG payment for injuries sustained by a patient falling is $25, 643 (Hart, Chen, Rashidee, and Sanjaya, 2009). This is significant in that with the developing atmosphere of pay-for-performance, initiated by CMS, hospitals now have a major monetary stake in reducing the number of fall-related injuries. The CDC estimates that the cost of fall injuries will exceed $23 billion within the next few years (Tzeng, 2008).
Wednesday, September 18, 2019
Analysing Invisible Man Essay -- Invisible Man Ralph Ellison Essays
Analysing Invisible Man After reading this book I wondered what it would be like to be blind then gain sight, but realize you cannot see yourself because you are invisible. It seems like a cruel joke that once you can see you realize that you still cannot see who you are. Even though this seems like a very depressing event Ellison makes it seem like a positive thing. While, at the end of the story, the narrator still does not know his place in the world he seems to be glad that he is no longer blindfolded. He even questions the reader's ability to see, "Who knows but that, on some lower frequencies, I speak for you?" What Ellison does well is the evolution of the narrator's blindness. The blindness motif seems to first show up at the battle royal. The blindfold scares the narrator. He was not used to darkness, and it put him in a "blind terror." This is the first time that the narrator admits his blindness, but at the same time he also shows the blindness of others. All of the men in the battle royal are blindfolded. Is this symbolic of the African-American's plight in society? The whites have blindfolded them and they have no idea who they are fighting against. So they end up beating each other rather than the real people they should be fighting. I think Ellison goes even deeper than mere race relations in this scene. I think he is showing the plight of the individual in society. I think Ellison is saying that we fight blindly amongst ourselves, and it is not until we take off the blindfolds that we can band together and fight the real enemy. When the narrator finally is allowed to remove his blindfold he is so preoccupied with what he believes he is there f or that he can not really focus on his fight with Tatlock. Again Ellison is commenting on the plight of the individual. The narrator is also blind to Dr. Bledsoe's true nature. It is not until later in the story that he realizes that Bledsoe wears different masks in front of different people. The narrator cannot be completely held at fault here because others are also fooled by Bledsoe. Bledsoe also dupes Barbee. Ellison then lets the reader know that Barbee is physically blind. Why is that fact important? I believe that Ellison is saying that anyone who buys into Bledsoe or Bledsoe's way of thinking is also blind. There is a point in Barbee's speech where he is "turning toward Dr. B... ... fact that he can be mistaken for Rinehart proves that Rinehart has no identity himself, but it also proves the same thing for the narrator. This seems to be why the narrator is never given a name. How do we identify people? By their names, and he has no identity so he is nameless. The Epilogue is as important as the Prologue. Here we learn that the narrator is ready to go out and search for his identity. However, now he seems to see himself as higher than others because of his experiences. He states that everyone has experienced the same thing he has, but on a "lower frequency." Is this conceit, or is he trying to relate to everyone? If it is conceit then I am less likely to trust the narrator and his point of view on all that happened to him. However, he speaks of his "social responsibility" so he seems to be a caring person, and it is because of this that I trust him. Questions: 1. Is Mr. Norton wrong in believing that the narrator is "his destiny"? 2. Who is the most "visible" person in the book? 3. Ellison seems to be speaking out against stereotyping, yet most of his characters are types rather than characters. Is he the very thing he is speaking out against?
Subscribe to:
Posts (Atom)